Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2020-07
  • 2020-08
  • br LC MS analyses in

    2020-08-18


    LC-MS analyses in SWATH-MS mode
    SWATH-MS datasets of the individual patients were acquired on a TripleTOF 5600+ mass spectrometer (SCIEX, Canada); the same chromatographic system, settings, and gradient Muscarine conditions as described above for spectral library generation were used. Using an isolation width of 9.7 m/z (containing 1 m/z for the window overlap), a set of 69 overlapping SWATH windows was constructed covering the precursor mass range of 400-1000 m/z. The effective isolation windows can be considered as 400.5-408.2 (first nar-rower window), 408.2-416.9, 416.9-425.6 etc. SWATH MS2 spectra were collected from 360 to 1460 m/z. The collision energy was optimized for each window according to the calculation for a charge 2+ ion centered upon the window with a spread of 15 eV. An accumulation time (dwell time) of 50 ms was used for all fragment ion scans in high-sensitivity mode, and for each SWATH cycle a survey scan was also acquired for 50 ms, resulting in a duty cycle of 3.5 s and a typical LC peak width of 30 s.
    Compared to the above conditions, for the analysis of pooled samples (see previous paragraph for pooling scheme) the parameters were changes as follows: (i) chromatographic separation of peptides was performed on 20-cm emitter (75 mm inner diameter, #PF360-75-10-N-5, New Objective, USA) packed in-house with C18 resin (Magic C18 AQ 3 mm diameter, 200 A˚ pore size, Michrom BioResources, USA); (ii) a linear gradient from 2%–30% solvent B (98% ACN/0.1% FA) was run over 120 min at a flow rate of 300 nl/min; (iii) because of the increased sample complexity due to the pooling strategy, a set of 64 SWATH windows (containing 1 m/z for the window overlap) with variable width optimized for human samples was used to cover the precursor mass range of 400-1200 m/z (Collins et al., 2017).
    TP53 sequencing
    Total cellular RNA was extracted using TRI Reagent (MRC). TP53 mRNA from tumor tissue was amplified using the SuperScriptTM III One Step RT-PCR System with Platinum Taq High Fidelity (Invitrogen, USA), sense primer: 50 TCCCCTCCCATGTGCTCAAGACTG 30 and antisense primer: 50 GGAGCCCCGGGACAAAGCAAATGG 30. PCR products were purified by MinEluteTM PCR Purification Kit (QIAGEN, Germany) and sequenced using the ABI PRISM BigDye Terminator v 3.1 Cycle Sequencing Kit on an ABI 3130 genetic analyzer (Applied Biosystems, USA).
    ERBB2 immunohistochemistry
    After removal of paraffin wax with xylene and rehydration, endogenous peroxidase activity was blocked with 3% hydrogen peroxide in phosphate buffered saline (PBS) pH 7.5, for 15 min. No antigen retrieval was performed. After three PBS washes, nonspecific bind-ing activity was blocked with 5% non-fat dried milk in PBS for 15 min. The cocktail of anti HER-2 primary Muscarine was diluted in antibody diluent (DakoCytomation, Denmark) to 1:500 for Novocastra NCL-c-erbB-2-316, and 1:1,000 for Novocastra NCL-L-CBE-356 (both Leica Biosystems, Germany) and applied overnight at 4 C. Reactive sites were identified with biotinylated anti-mouse and anti-rabbit secondary antibodies and peroxidase ABC reagents (Vector-Elite, Vector Laboratories, USA) according to the manufac-turer’s instructions and peroxidase activity was visualized with DAB+ reagents (DakoCytomation). Sections were washed in distilled water and counterstained with Gills hematoxylin, dehydrated, cleared, and mounted. Membrane staining of tumor cells was evalu-ated as 0, 1+, 2+, 3+ according to the HercepTestTM Interpretation Manual (DakoCytomation).
    Validation of SWATH-MS quantitation through selected reaction monitoring
    Aliquots of the same tryptic digests were used for (i) SWATH-MS (as described above) and for (ii) selected reaction monitoring (SRM) with mTRAQ labeling (as described previously (Procha´zkova´ et al., 2017)). Shortly, aliquots for SRM were labeled by mTRAQ prior to the analysis. For mTRAQ labeling, two aliquots from each sample corresponding to 10 mg of digested protein were processed. One sample group was labeled with mTRAQ-D0 and the other sample group was labeled with mTRAQ-D8 label. Samples labeled with mTRAQ-D8 were pooled together to create global internal standard. This pool was then divided into 96 aliquots that were added to each mTRAQ-D0 labeled sample and measured in SRM as described previously (Procha´zkova´ et al., 2017).
    QUANTIFICATION AND STATISTICAL ANALYSIS
    SWATH-MS assay library generation
    Raw data files (wiff) were centroided and converted into mzML format using the SCIEX converter (beta release 111102) and subse-quently converted into mzXML using openMS (version 1.9.0, Feb 10 2012, Revision 9534). The converted data files were searched using the search engines X!Tandem (k-score, version 2011.12.01.1) and Comet (version 2013.02, revision 2) against all human pro-teins annotated in UniProt/SwissProt (2014_04) and the sequences of 11 iRT peptides (iRT-kit, Biognosys). The searched database also contained a decoy protein sequence (reversed protein sequence) for each database protein. Only fully tryptic peptides with up to two missed cleavages were allowed for the database search. The tolerated mass errors were 15 ppm on MS1 level and 0.1 Da on MS2 level. Methylthiolation of cysteines was defined as a fixed modification and methionine oxidation as a variable modification. The search results were processed with PeptideProphet (Keller et al., 2002) and iProphet (Shteynberg et al., 2011) as part of the TPP 4.6.0 (Deutsch et al., 2010). The SWATH-MS assay library was constructed from the iProphet results with an iProphet cut-off of 0.8360 which corresponds to 1% FDR on peptide level. The raw and consensus spectral libraries were built with SpectraST (version 4.0) (Lam et al., 2007; Lam et al., 2008) using the -cICID_QTOF option for high resolution and high mass accuracy. Retention times were normalized and converted to iRT space using spectrast2spectrast_iRT.py (imsproteomicstools R356). The 6 most intense y and b fragment ions of charge state 1, 2 and 3 were extracted from the consensus spectral library using spectrast2tsv.py (imsbproteomicstools). Neutral losses 17 (NH3), 18 (H2O) and 64 (CH4SO, typical for oxidized methionine) were also included if they were among the 6 most intense fragment ions. Fragment ions falling into the SWATH window of the pre-cursor were excluded as the resulting signals are often highly interfered. The library was converted into TraML format using the OpenMS tool ConvertTSVToTraML (version 1.10.0). Decoy transition groups were generated based on shuffled sequences (decoys similar to targets were excluded) by the OpenMS tool OpenSwathDecoyGenerator (version 1.10.0) and appended to the final SWATH library in TraML format.